PrimerThermoHybridPCR - On line help

Sequence

Your input sequence should contains only letters representing nucleotides (IUPAC code), any other character will be ignored (except special instruction, see below). The software is case insensitive (i.e. you can analyze both upper- and lowercase sequences).

Main Sequence

It's possible to insert additional instruction for the software using special characters: [ ] and < >.
You can delimite with square brackets the piece of sequence you want to amplify (like this: TT[ACT]AG). The program will desing primers flanking the delimited region. Please, note that you can't use a single bracket. If you don't mark the source sequence with brackets, then the primer will be build in any part of sequence, e.g. :

  acccttcggcacgacacacacag[accgcttgaaagctgcacaaacccgtagac]cgtgcgcgcccaatgcccaaacccaa
     >>>>>>>>>>>>>>      [ - - - - - no Primer - - - -  ]    <<<<<<<<<<<<<<<
       Primer for                                                 primer Rev

If you want to exclude some regions you can put angular brackets (like this: TT<ACT>AG..). Such regions will be excluded from primer selection. e.g. :

  acgttgcgcgcgagagcgcagccgag < gaaggcttccggaagtcgcataaggctctcg > cgcgaaccccaggagagagccaa  
                             <   regione forbids of primers    >

Similar Sequence

Sometimes you need to use the same pair of primers to clone a set of genes (i.e. orthologous genes from different species, or different alleles of the same gene). On the other hand, sometimes you need to avoid that a primers pair can amplify some other sequence related to the one you are studying.
In these cases you can put one or more similar sequence (in FASTA or Multi FASTA format) in the Similar Sequences box, and then select the appropriate option to make PrimerThermoHybridPCR select primers that can amplify both main and all similar sequence(s) or that will not any amplify similar sequence(s).

Temperature

Annealing Temperature (Ta): This is the temperature of primer-template hybridization in the PCR experiment.
Melting temperature (Tm): At Tm temperature half DNA template is hybridized to primer, the other half is free.
Delta Melting temperature (Tm-Ta): This is the difference between the experimental annealing temperature, and the desired primer melting temperature.
Tm rappresenta la temperatura di melting con la quale si vogliono disegnare i pimer.

To reach maximum amplification efficiency, all template DNA, at each cycle, should be primed. This is possible if primers melting temperature is higher than annealing temperature. Usually, as sugegsted by hybridizaation diagrams generated by OligoMelting, Tm should be 3-4°C above the annealing temperature (Tm > Ta + 4°C).

A cautious choiche could be designing primers with a higher melting temperature, but, on the other hand, this could result in a higher probability of aspecific products.
Ideal annealing temperature depends on the goal of our PCR, and differs from application to application:

Primers to sequence or amplify DNA
Tailed primers
Real-Time PCR
SNP detection
Similar sequence present in the genome
and so on...

Please, find further hints on dedicated PCR manuals.

Concentrations

Primers concetration: usually 0.2 - 0.5 micromolar. Varying primers concentration doesn't affect PCR reaction so much.
Usually higher primer concentrations are used with short amplicons or using melting temperature close to annealing temperature (thus with more primers you get a higher fraction of hybridized template DNA).
[Na+] or Monovalent Cations Concentration: usualy Sodium or Potassium (K+), it's commonly about 50 mM.
[Mg++] Divalent Cations Concentration: it's required for catalytic activity of DNA polymerase. Usually 1.5 mM.

Notes:
Salt concentration heavily affects PCR reactions. Higher concentrations stabilize hybridization, thus lowering melting temperature. Using more salts, you should decrease annealing temperature.
Mg++ concentration it's very important. His effect on melting temperature is about 100 times Na+ one, thus small variations (0.5 mM) on [Mg++] can change melting temperature. Several prediction tools don't consider this parameter, that is crucial for accurate predictions.

Products size

You can specify minimal, maximal and optimal product size.

min : Primers giving PCR products shorter than this value will be ignored.
max : Primers giving PCR products longer than this value will be ignored.
opt : Optimal amplification size. Set this value to "0" to ignore this.
Penalty for 100 bp : This is a penalty for each 100bp of differece between optimal size and actual size. In other words, for each amplicon 1 base longer/shorter than the optimum a penalty of (penalty_value/100) will be applyed. Set this value to "0" to ignore this (i.e.: optimal value will ignored too!).

DNA Polymerase

The first step of PCR involves a transition from low temperature to annealing temperature. At low temperature aspecific hybridizations can occur, and if hybridization involves primer 3', the polymerase can elongate such primers giving undesired products and wasting primers.

hot start: Engineered DNA polymerases (called hot start) are active only at high temperature, thus eliminating the risk of aspecific amplifications. Using this kind of enzyme you can design primers with otherwise dangerous loops or dimer-forming without risks. Anyway you should check this option only if you don't get satisfying primers with "normal" prediction.
Proofreading: Commonly used DNA polymerases lack a proofreading activity and are sensitive to 3' primer march. A single mismatch in this region could prevent elongation. Also, such DNA polymerase don't correct misincorporation errors (1/1000 bases average) thus giving low quality products.
On the other hand, using Proofreading DNA polymerase you have better quality PCR products. This activity allow the enzyme to elongate primers aspecifically hybridized (i.e. at low temperature) or self-hetero dimers and hairpin loops even if 3' mismatches are present. In this case the program discard primers that can form dangerous and unwanted hybrids.

Pick primer or use your primer

Checking the pick [left/right] primer radio button, RapHybridPCR will suggests best primers using setted parameters.

If you want to try with your own primers (one or both), just paster them in the appropriate input field and check the "use this primer" radio button. The software will perform all primer analysis (self-dimer, hairpins etc...) on your primers, rather than looking for suitable primers from scratch. Program output will contain some warnings if your primers don't exist in the sequence or if their melting temperature is unsuitable with annealing temperature you want to use.

Using only one primer, the software will design the other one (a set of primers, scored from best to worst...)

Display

Number to return: this value specify the number of primer pairs to display in output
Max occurence same primer: how many times a single primer can appear in the output list. This option is to avoid that the same primer is displayied several times (with other primers).

Advanced settings

Primer length

- min : This is the minimum length for each primer (in bp).
- max : This is the maximum length for each primer (in bp).

These settings are not that importatn, as the software determine primer length basing its calculation on melting temperature. Short primers have to be rich in GC, while longer primers in AT, thus would be penalyzed in subsequent analysis (stretches, hairpins, loops etc.).

. . . . . . . . . . UNDER COSTRUCTION . . . . . . .